Users Online: 1088

Home Print this page Email this page Small font sizeDefault font sizeIncrease font size

Home | About us | Editorial board | Search | Ahead of print | Current issue | Archives | Submit article | Instructions | Subscribe | Contacts | Login 
     

   Table of Contents      
ORIGINAL ARTICLE
Year : 2014  |  Volume : 4  |  Issue : 4  |  Page : 224-230

Evaluation of ethanolic extract of Cucumis melo L. for inflammation and hyperplasia of prostate


Department of Pharmacology, University College of Pharmacy, Cheruvandoor Campus, Kottayam, Kerala, India

Date of Submission16-Apr-2014
Date of Acceptance18-May-2014
Date of Web Publication22-Aug-2014

Correspondence Address:
Sibi P Ittiyavirah
Department of Pharmacology, University College of Pharmacy, Cheruvandoor Campus, Kottayam - 686 631, Kerala
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2231-0738.139403

Rights and Permissions
   Abstract 

Aim: The hypothesis of the current study is to evaluate the therapeutic potential of ethanolic extract from Cucumis melo L to act as an anti-inflammatory and anticancer agent on the protate gland. Materials and Methods: The study was evaluated by performing various in vitro and in vivo experiments with wistar albino rats. The statistical analysis was carried out using one-way ANOVA followed by Dunnett's multiple comparisons for the data which were normally distributed. Results: The ethanolic extract of Cucumis melo L. (EECM) shows reduction in hyperplasia of the prostate which is observed by the decrease in total weight when compared to the positive control and hence is beneficial in benign prostatic hyperplasia (BPH) and also possesses apoptotic activity which is observed by acridine orange and ethidium bromide double staining and then visualized by Fluorescent microscopy. The result showed that the ethanolic extract is capable of reducing the prime inflammatory mediator TNF-α and hence reduces inflammation.

Keywords: Apoptosis, Cucumis melo L., cytotoxicity, hyperplasia, inflammation


How to cite this article:
Ittiyavirah SP, Cheriyan S. Evaluation of ethanolic extract of Cucumis melo L. for inflammation and hyperplasia of prostate. Int J Nutr Pharmacol Neurol Dis 2014;4:224-30

How to cite this URL:
Ittiyavirah SP, Cheriyan S. Evaluation of ethanolic extract of Cucumis melo L. for inflammation and hyperplasia of prostate. Int J Nutr Pharmacol Neurol Dis [serial online] 2014 [cited 2018 Nov 18];4:224-30. Available from: http://www.ijnpnd.com/text.asp?2014/4/4/224/139403


   Introduction Top


Old medicinal systems around the world lead to the discovery of therapeutically active compounds from plants. Combination of traditional and modern knowledge can produce better drugs of therapeutic value with fewer side effects. Diseases affecting the prostate gland in men include prostatitis, BPH and prostate carcinoma which need a remedy or relief. Prostatitis, the inflammation of the prostate gland usually develops rapidly (acute) or slowly (chronic) eventually leading to repeated bladder infections. The aim of the study is to examine the effect of ethanolic extract of C. melo on inflammation and hyperplasia of prostate and also cytotoxic activity on PC3 cell line by cytotoxicity assays.


   Materials and methods Top


Rat models

Male Wistar albino rats weighing 170-220g were housed in standard laboratory conditions at temperature of 22 ± 3ºC, relative humidity 50-55% and 12 hr light-dark cycle in polyacrylic cages. Drinking water and pellet diet were supplied ad libitum throughout the study period. The experiments were performed after getting the approval for experimental protocol from institutional animal ethics committee (IAECno: 015/MPH/UCP/CVR/12).

Preparation of ethanolic extract

The C. melo L. (fruit) was collected from a fruit stall at Kanjikuzhy, Kottayam, and authenticated by Dr. Jomy Augustine. The fruit was peeled, sliced, and subjected to extraction by percolation method using ethanol as solvent. C. melo L. around 4 kg was sliced, pulverized, soaked overnight in 50%v/v ethanol and then extracted by percolation apparatus, filtered. The extraction was carried out in portions which was combined, air dried, weighed, and percentage yield calculated.

Experimental design

State hyperplasia was induced in male Wistar rats by administration of testosterone depot injection and there occurs abnormal increase in cell volume and size at different locations of the prostate gland and also inflammation and hence infiltration of inflammatory mediators. For 28 days the rats were administered with arachis oil (control group), positive control group was treated with Testosterone depot injection dissolved in arachis oil (3 mg/kg) s.c, weekly, standard group received Finasteride 5 mg/kg/p.o. and test group received the EECM 500 mg/kg. The standard and test group also received testosterone depot injection 3 mg/kg/s.c./weekly. On day 28, the rats were euthanized and sacrificed, excised and removed prostate gland and evaluated for the individual weights of prostate gland and then calculated their total weights. The individual weights of prostate gland was recorded from both right and left lobe and the total weight was calculated by summing the individual weights. Biochemical estimation of the key inflammatory mediator for prostatitis, Tumor necrosis factor-α (TNF-α) and histological studies were also performed. Prostate hyperplasia being an androgen-dependent disease led to the selection of this model for evaluating the EECM in hyperplasia of the prostate.

In vivo studies

RT-PCR analysis of TNF-α expression by isolation of total RNA (TRIZOL METHOD)

The isolated prostate glands were placed in freshly prepared phosphate buffer saline solution for estimation of TNF-α and to determine the percentage difference in expression by reverse transcription-polymerase chain reaction (RT-PCR) technique.

Total Ribonucleic acid (RNA) was isolated using the total RNA isolation kit according to the manufacturer's instruction (TRIzol ® Plus RNA Purification Kit, Ambion ® )

RT- PCR analysis

RT-PCR is a variant of polymerase chain reaction laboratory commonly used in molecular biology to generate many copies of a deoxyribonucleic acid (DNA) sequence, a process termed "amplification". In RT-PCR, however an RNA strand is first reverse transcribed into its Complementary DNA (cDNA) using the enzyme reverse transcriptase and the resulting cDNA is amplified using PCR or real time PCR.

RT-PCR technique was performed using primer designed specifically for amplified gene. About 5 μl of extract was treated with RNA, 1 μl of forward primer and reverse primer were added to an RNAse free tube. The sequence of the forward primer TNF-α is (5'CCCAGGCAGTCAGATCATCCTTC3') and the sequence of the reverse primer TNF-α is (5'AGCTGCCCCTCAGCTTGA3'). To this mixture 10 μl of prime RT-PCR premix was added, making the total reaction volume up to 20 μl with the addition of distilled water. The solution was mixed by pipetting gently up and down. The PCR machine was then programmed to undergo cDNA synthesis and amplification. The followed cycling conditions were employed in the DNA thermal cycler. Initial DNA synthesis at 42°C for 30 mins, denaturation at 94°C for 10 mins, denaturation repeated at 94°C for 1 min annealing at 58°C for 1 min and extension at 72°C for 1 min. The steps denaturation, annealing, and extension were repeated for 35 cycles and the final extension at 72°C for 5 mins. After the amplification, the PCR product was separated by agarose gel electrophoresis.

Agarose gel electrophoresis

Agarose gel electrophoresis was performed to check the purity of isolated messenger RNA. The electrophoretic buffer was poured in the gel tank and the platform with the gel was placed in it so as to immerse the gel. The amplified RNA sample was switched on and it was observed that RNA bands started migrating toward the anode. The stained gel was visualized using an ultraviolet trans-illuminator. The intensity of the bands was analyzed using the IMAGE J analysis software. [1]

In vitro studies

Cytotoxicity assays

PC3 cell lines were purchased from NCCS Pune and maintained in Dulbecco's modified eagles media (HIMEDIA) supplemented with 10% FBS (Invitrogen) and grown to confluency at 37ºC, 50% CO 2 (NBS, EPPENDORF, Germany) in a humidified atmosphere in a CO 2 incubator. The cells were trypsinized (500 μl, 0.025% Trypsin in PBS/0.5 mM EDTA solution (Himedia) for 2 mins and passed to T flasks in complete aseptic conditions. Extracts were added to grown cells at a concentration of 10 μg, 50 μg, and 100 μg from a stock of 10 mg/ml and incubated for 24 hrs. The % difference in viability was determined by standard cytotoxicity assays.

MTT assay

MTT is a colorimetric assay that measures the reduction of yellow 3-(4, 5 dimethylthiazol-2-yl)-2, 5- diphenyltetrazolium bromide (MTT) by mitochondrial succinate dehydrogenase. The MTT enters the cell and passes into the mitochondria where it is reduced to an insoluble, colored (dark purple) formazan product. The cells are then solubilized with an organic solvent Dimethyl sulfoxide (DMSO) and the released, solubilized formazan product was measured at 540 nm. Since reduction of MTT can only occur in metabolically active cells the level of activity is a measure of cell viability.

The cell culture suspension was washed with 1x phosphate buffer saline (PBS) and then added 30 μl of MTT solution to the culture (MTT -5 mg/ml dissolved in PBS). It was then incubated at 37ºC for 3 hrs. MTT was removed by washing with 1x PBS and 200 μl of DMSO was added to the culture. Incubation was done at room temperature for 30 mins until the cell got lysed and color was obtained. The solution was transferred to centrifuge tube and centrifuged at top speed for 2 mins to precipitate cell debris. Optical density (OD) was read at 540 nm using DMSO as blank.

% viability = (OD of Test/OD of Control) ×100 [2]

Neutral red assay

The neutral red cytotoxicity assay was based on the ability of living cells to uptake and bind neutral red (NR). NR was a positively charged dye that easily diffuses through the cellular membrane of the cells, accumulates in cellular cytoplasm and was stored in the acidic environment of lysosomes.

The principle of the test is based on the fact that NR are able to absorb and bind only live cells while this ability declines in damaged or dead cells. The amount of accumulated NR was thus directly proportional to the amount of live cells in the cell culture. Treated cells were incubated for 3 hrs with neutral red dye. The pH of the neutral red solution was adjusted in all the experiments to 6.35 with the addition of KH 2 PO 4 (1M). Cells were then washed with phosphate buffer saline and the addition of 1 ml of the elution medium (ethanol/acetic acid, 50%/1%) followed by gentle shaking for 10 mins so that complete dissolution is achieved. Aliquots of the resulting solutions were transferred to cuvettes and absorbance at 540 nm was recorded using the spectrophotometer.

% viability = (OD of Test/OD of Control) ×100 [3]

Lactate dehydrogenase assay

Lactate dehydrogenase (LDH) assay is used as a quantitative marker enzyme for the intact cell, its activity providing information on cellular glycolytic capacity. Measurement of LDH release (leakage) is an important and frequently applied test for severe irreversible cell damage.

Enzymatic reaction catalyzed by lactate dehydrogenase is:

Pyruvate + NADH + H+ → L- lactate + NAD+

LDH leakage assay was performed with cell free supernatant collected from tissue culture plates. To this added 2.7 ml potassium phosphate buffer, 0.1 ml, 6 mM NADH solution, 0.1 ml sodium pyruvate solution into a cuvette and mixed well. The increase of OD was recorded at 340 nm in a spectrophotometer, thermostated at 25°C. The blank solution was prepared by adding enzyme dilution buffer instead of sample. Activity of lactate dehydrogenase can be calculated by using the formula:

Volume of activity (U/ml) = Δ [(OD at 0 min- OD at 5 min) ×3(ml) x DF] χ [6.2 × 0.1] [4]

Protein denaturation assay

A solution of 0.2%w/v BSA was prepared in Tris HCl buffer saline (10 mM Tris pH 8, 150 mM NaCl and distilled water) and pH was adjusted to 6.8 using glacial acetic acid. Stock solutions of 10000 μg/ml of all extracts were prepared by using methanol as solvent. From these stock solutions, five different concentrations of 100, 200, 300, 400, and 500 μg/ml were prepared by using methanol as solvent. Five milliliters of 0.2%w/v BSA was added to all above tubes. Control consists of 5 ml, 0.2%w/v BSA with 50-μl methanol. Standard consists of Diclofenac sodium drug in methanol 100 μg/ml with 5 ml, 0.2%w/v BSA solution. The test tubes were heated at 72ºC for 5 mins and then cooled for 10 mins.

The absorbance of these solutions was determined using spectrophotometer at a wavelength of 660 nm. The percentage of denaturation of protein was determined on a % basis relative to the control using the following formula:

% inhibition = (OD of control - OD of test)/OD of control × 100 [5]

Apoptosis by acridine orange and ethidium bromide double staining

DNA-binding dyes AO and EB (Sigma, USA) were used for the morphological detection of apoptotic and necrotic cells Zhang et al. [6] AO is taken up by both viable and non-viable cells and emits green fluorescence if intercalated into DNA. EB is taken up only by non-viable cells and emits red fluorescence by intercalation into DNA. After treatment with different concentrations of plant extracts, at a final concentration of 250 μg/ml for 24 hrs, cells were washed with cold PBS and then stained with a mixture of AO (100 μg/ml) and EB (100 μg/ml) at room temperature for 10 mins. The stained cells were washed twice with PBS and observed by a fluorescence microscope in blue filter.

Cells were divided into four categories as follows:

  • Living cells - normal green nucleus
  • Early apoptotic - bright green nucleus with condensed or fragmented chromatin.
  • Late apoptotic - orange-stained nuclei with chromatin condensation or fragmentation
  • Necrotic - uniformly orange-stained nuclei. [6]


Antimicrobial assay

The test organism used for the study was Escherichia coli which were grown in nutrient broth at 37ºC for 24 hrs.Thirty-eight grams of Muller Hinton media (Hi-media) was mixed with 2 l distilled water (pH 7.5) and then sterilized in autoclave at 15lb pressure for 15 mins. The sterilized media was then poured into a Petridish. The solidified plates were bored with the help of a 5-mm diameter tip and these plates with well plates were used for the antibacterial study.

One gram of the extract was dissolved in DMSO and from this 400, 200, 100, and 50 μg/ml concentration of each extract were tested against E. coli for their antibacterial activity. It was demonstrated by well diffusion method and activity was evaluated by measuring zone of inhibition. The results were compared with that of standard Gentamycin 10 μg/ml. [7]


   Results and discussion Top


In the present study, the cytotoxic activity of EECM was evaluated by MTT assay, Neutral red reuptake assay and lactate dehydrogenase assay using highly metastatic human prostate carcinoma cell line (PC3). MTT assay and Neutral red reuptake assay confirms the dose dependant antiproliferative effect of crude EECM, i.e. as dose of extract increases, number of viable cells decreases. The result of MTT Assay using different concentrations of EECM is presented in [Figure 1]. From the figure, IC 50 value of EECM was found to be 220.0 μg/ml and a dose-dependant decrease in % viability of PC3 cell lines against MTT assay was observed. The result of neutral red assay using different concentrations of EECM is presented in [Figure 2]. From the figure, IC 50 value of EECM was found to be 360.0 μg/ml and a dose-dependant decrease in % viability of PC3 cell line against Neutral Red assay was observed. In MTT assay and Neutral red assay, 400 μg/ml EECM shows 39.5 and 48.94% viability, respectively, confirming the cytotoxic activity. The MTT assay and Neutral Red assay measures the viable cells.
Figure 1: Comparison of percentage viability of cells using different concentrations of EECM by MTT assay

Click here to view
Figure 2: Comparison of percentage viability of cells as observed with different concentrations of EECM by neutral red assay

Click here to view


Lactate dehydrogenase assay detects the dead cells by measuring the activity of marker enzyme that leaks out of dead cells into the culture medium. The percentage viability of prostate cancer cells decreased significantly when treated with EECM and the volume of enzyme activity measured in lactate dehydrogenase assay had progressed in a dose-dependent manner due to the release of enzyme caused by irreversible cell death. The result of lactate dehydrogenase assay using different concentrations of EECM is presented in [Figure 3]. There is a dose-dependant increase in volume of lactate dehydrogenase enzyme released by damaged cells of PC3 cell lines when treated with the EECM. So, EECM may possess cytotoxicity activity.

Anti-inflammatory activity of EECM was evaluated by protein denaturation assay on bovine albumin solution using different concentrations ranging from 100 to 500μg/ml. It was found that EECM at 100 μg/ml offered a % inhibition of 37.41 ± 0.20 and in 300 μg/ml it further increased to 41.78 ± 0.26 and in 500μg/ml it could offer 65.03 ± 0.17. A dose-dependent increase in inhibition was observed for all concentrations. Diclofenac was used as standard. Protection against protein denaturation may play an important role in prostatitis which was exhibited by EECM in a dose dependant manner by inhibiting proteinases which are the main causes for tissue destruction. The result of Protein denaturation assay using different concentrations of EECM is presented in [Figure 4]. Statistical evaluations showed that there was no statistically significant difference between percentage inhibition of standard and extract corresponding to each concentration with a P value of 0.431, i.e. EECM possess significant protein denaturation activity as compared to Diclofenac.
Figure 3: Comparison of volume of enzyme activity as observed with different sample concentrations of EECM through Lactate dehydrogenase assay

Click here to view
Figure 4: Effect of EECM when compared with standard drug, Diclofenac sodium on inhibition of protein denaturation

Click here to view


Apoptosis is the process of programmed cell death that may occur in multicellular organisms due to biochemical events which leads to characteristic cell changes. Based on fluorescence produced the cells were divided into four categories: Living cells - normal green nucleus, early apoptotic - bright green nucleus with condensed or fragmented chromatin, late apoptotic - orange-stained nuclei with chromatin condensation or fragmentation, necrotic - uniformly orange-stained nuclei. From the fluorescent microscopic images, it is evident that EECM does possess apoptotic activity at a concentration of 250 μg/ml. The images obtained by AO and EB double staining through fluorescent microscopy for apoptosis is shown in [Figure 5].
Figure 5: Photomicrographs of images obtained through fluorescent microscopy for apoptosis

Click here to view


Prostatitis is usually caused by bacterial infections and maybe acute or chronic in nature and accounts about 80-85% of total infection in elderly men. [8] In the present study, antibacterial activity was determined at four different concentrations of EECM using E. coli bacteria by Agar well diffusion method using gentamycin as standard. Zone of inhibition in mm was measured. From this testing it was evident that EECM possessed antibacterial activity which makes it an eligible agent in prostatitis. The antibacterial activity of the extract against E. coli is shown in [Figure 6].
Figure 6: Antibacterial assay of EECM against E. coli by Well plate method

Click here to view


The [Figure 7] shows animals treated with EECM (Group III) at a dose of 500 mg/kg which produced considerable reduction in total prostate weight (P < 0.001) on Day 28 as compared to the control (Group II). Group III animals treated with 5 mg/kg of standard drug, Finasteride also produced highly significant decrease in total prostate size on Day 28 (P < 0.001) as compared to positive control animals (Group II). The EECM shows reduction in hyperplasia of the prostate which is observed by the decrease in total prostate weight when compared to the positive control and hence is beneficial in benign prostatic hyperplasia.
Figure 7: Effect of EECM on prostate weight in hormone-induced model in rats

Click here to view


Men with prostatitis had higher levels of TNF-α than normal men and hence there is a strong correlation among the levels of TNF-α in semen of men with chronic prostatitis. [9] The evaluation of the inflammatory parameter TNF-α by RT PCR analysis has showed a considerable difference in its expression between Finasteride group and testosterone depot group. Graphs drawn from calculations made by Image J analyser indicated that the amount of TNF-α in test group was almost the same as that of Finasteride group which indicates that EECM is capable of reducing the prime inflammatory mediator TNF-α and hence reduce inflammation. The EECM shows reduction in % difference in expression of TNF-α as similar to standard when compared to the positive control which is shown in [Figure 8].
Figure 8: RT-PCR analysis of TNF-á expression in rats with hyperplasia

Click here to view


Histopathological examinations were done by Hematoxylin and Eosin staining method. The histopathological investigations revealed that the pretreatment with EECM has reduced hyperplasia or cell size as shown in [Figure 9].
Figure 9: Photomicrographs of histology slides

Click here to view


  1. Represents the control animal, showing no abnormality.
  2. Represents the positive control group in which multifocal hyperplasia and mild proliferation of blood vessels and fibrous tissue is seen.
  3. Represents the standard group in which hyperplasia seems to have reduced and acini dilated.
  4. Represents Test group which shows dilated acini and decreased hyperplasia.


 
   References Top

1.Sakthivel E, Jayshree N. Pharmacological evaluation of a polyherbal formulation for the management of benign prostatic hyperplasia. Int J Curr Pharm Res 2013;5:8-12.  Back to cited text no. 1
    
2.Arung, Wicaksono, Handoko, Kusuma, Yulia D, Sandra F. Anti-cancer properties of diethyl ether extract of wood from sukun (Artocarpusaltilis) in human breast cancer (T47D) Cells. Trop J Pharm Res 2009;8:317-24.  Back to cited text no. 2
    
3.Zhang X, Zang N, Wei Y, Yin J, Teng R, Seftel A, et al. Testosterone regulates smooth muscle contractile pathways in the rat prostate: Emphasis on PDE% signaling. Am J Physiol Endocrinol Metab 2013;302:E243-53.  Back to cited text no. 3
    
4.Alo H, Savita Dixit. In vitro antimicrobial activity of flavonoids of Ocimum sanctum with synergistic effect of their combined form. Asian Pac J Trop Dis 2012;S396-8.  Back to cited text no. 4
    
5.Verma AM, Kumar AP, Kavita D, Anurag KB. Antidenaturation and antioxidant activities of Annona cherimola in vitro. Int J Pharma Biosci 2011;2:1-6.  Back to cited text no. 5
    
6.Zhang JH, Yu J, Li WX, Cheng CP. Evaluation of Mn2 + stimulated and Zn2 + inhibited apoptosis in rat corpus luteal cells by flow cytometry and fluorochromes staining. Chin J Physiol 1998;41:121-26.  Back to cited text no. 6
    
7.Ali H, Dixil D. In vitro antimicrobial activity of flavanoids of Ocimum sanctum with synergistic effect of their combined form. Asian Pac J Trop Dis 2012;S396-8.  Back to cited text no. 7
    
8.McPhee SJ and Papadakis MA. 2010 Current Medical Diagnosis and Treatment. New York: McGraw Hill Medical; 2010.  Back to cited text no. 8
    
9.Alexander RB, Ponniah S, Hasday J, Hebel JR. Elevated levels of proinflammatory cytokines in the semen of patients with chronic prostatitis/chronic pelvic pain syndrome. Urology 1998;52:744-49.  Back to cited text no. 9
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and me...
    Results and disc...
    References
    Article Figures

 Article Access Statistics
    Viewed1468    
    Printed58    
    Emailed1    
    PDF Downloaded187    
    Comments [Add]    

Recommend this journal