Users Online: 45

Home Print this page Email this page Small font sizeDefault font sizeIncrease font size

Home | About us | Editorial board | Search | Ahead of print | Current issue | Archives | Submit article | Instructions | Subscribe | Contacts | Login 
     

   Table of Contents      
ORIGINAL ARTICLE
Year : 2014  |  Volume : 4  |  Issue : 4  |  Page : 203-213

Ferulic acid prevents ultraviolet-B radiation induced oxidative DNA damage in human dermal fibroblasts


Department of Biochemistry and Biotechnology, Annamalai University, Chidambaram, Tamil Nadu, India

Date of Submission28-Mar-2014
Date of Acceptance16-Apr-2014
Date of Web Publication22-Aug-2014

Correspondence Address:
Rajendra Prasad Nagarajan
Department of Biochemistry and Biotechnology, Annamalai University, Annamalainagar 608 002, Chidambaram, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2231-0738.139400

Rights and Permissions
   Abstract 

Aim: Protective effects of ferulic acid (FA) against ultraviolet-B (290-320 nm) radiation induced cellular changes were investigated in human dermal fibroblasts (HDFa). Materials and Methods: HDFa cells pretreated with increasing concentrations of FA (0, 10, 20, 40 μg/ml) for 30 min, were UVB irradiated and different cellular and oxidative end points were analyzed. Results: The percentage of cytotoxicity, intracellular reactive oxygen species (ROS) levels, mitochondrial membrane potential, thiobarbituric acid reactive substances (TBARS) and DNA damage, were significantly increased in 19.8 mJ/cm 2 ultraviolet-B (UVB)-exposed HDFa. Further, exposure to UVB causes significantly decreased antioxidants status in HDFa cells. Treatment of HDFa cells with FA before 30 min of UVB-irradiation significantly restored mitochondrial membrane potential, ROS levels and antioxidant status in HDFa. Further, FA treatment reverted UVB-induced mutagenesis in Ames tester strains and DNA damage in HDFa. Moreover, we noticed increased expression of GADD 45α, XRCC1 and HOGG1 in UVB exposed HDFa. Conversely, FA pretreatment significantly attenuated UVB-induced expression of DNA repair genes in HDFa. Conclusion: The present findings indicate that FA act as a sunscreen rather than working at molecular level to offer photoprotection.

Keywords: Antioxidants, cytotoxicity, DNA damage, ferulic acid, ultraviolet radiation


How to cite this article:
Ambothi K, Nagarajan RP. Ferulic acid prevents ultraviolet-B radiation induced oxidative DNA damage in human dermal fibroblasts. Int J Nutr Pharmacol Neurol Dis 2014;4:203-13

How to cite this URL:
Ambothi K, Nagarajan RP. Ferulic acid prevents ultraviolet-B radiation induced oxidative DNA damage in human dermal fibroblasts. Int J Nutr Pharmacol Neurol Dis [serial online] 2014 [cited 2019 Aug 23];4:203-13. Available from: http://www.ijnpnd.com/text.asp?2014/4/4/203/139400


   Introduction Top


Epidemiological studies reveal that about 1.3 million new cases of non-melanoma skin cancers are diagnosed every year in the United States alone. Solar ultraviolet (UV) radiation is considered as the most prevalent environmental carcinogen. [1],[2] UVB (290-320 nm) component of the solar UV spectrum can act as tumor initiator, tumor promoter and as a complete carcinogen by damaging cellular macromolecules such as DNA, proteins and lipids. [3] It is well documented that UV irradiation generates reactive oxygen species (ROS), such as singlet oxygen, peroxy radicals, superoxide anion and hydroxyl radicals, which creates a state of oxidative stress in the target cells. Mainly this UVB-induced oxidative stress arises when the formation of ROS exceeds the antioxidant defense ability of the target cells. UVB-induced ROS act as tumor initiator and tumor promoter and thereby activating number of cell signaling events. [4],[5],[6],[7] Thus, UVB-induced ROS generation has been implicated in many disease processes including skin cancer. [8] It has been recognized that UV-induced DNA damage plays an important role in immunosuppression and skin cancer initiation. The DNA strand break, thymine glycols and 8-hydroxyguanine are the forms of oxidative DNA damage induced by both UVB (290-320 nm) and UVA (320-400 nm) exposure. [9]

Mammalian cells possess efficient mechanisms to preserve genomic stability; however, if the damage is too severe after a higher dose of UV irradiation, cells have a mechanism to trigger apoptosis to prevent the propagation of the damaged DNA. [10] Accumulation of UVB-induced DNA lesions results in mutations in critical genes and contributes to the development of non-melanoma skin cancers. A number of method which includes, (a) avoiding direct exposure to the sun light, or (b) protecting exposed areas of skin by wearing hats/clothing to adequately cover the body from direct sunlight or using sun screens with sun protection factor >16, have been suggested to prevent direct exposure from the sun and thus to minimize the occurrence and risk of skin cancer, however, their practical compliance is an issue. Therefore, there is an urgent need to look for alternative preventive approaches.

Various plant-derived phytochemicals possess antioxidant properties and thus offering photoprotection. Some of these agents popularly known as "photochemopreventive agents" are also present in the human diet and many such agents have also found a place in various skin care products. Understanding how such phytochemicals exert their effects is not only important but essential to the development of better and more effective photochemopreventive products for general human use. [11] Recently, phenolic phytochemical have been proposed as novel agents in the prevention of free radical-related diseases such as neurodegenerative disorders, cancer, acute and chronic inflammation and aging. Ferulic acid (FA) is a phenolic compound (4-hydroxy-3-methoxy cinnamic acid) and an antioxidant found in many fruits, vegetables, cereals, coffee, and herbs. [12] FA has been shown to protect against DNA damage, cancer, and other human disorders. [12],[13] FA possesses three distinctive structural motifs that can be possibly contributed to the free-radical scavenging capability of this compound. We have already reported the photoprotective effect of FA in human blood lymphocytes. [14] As the human skin is the major organ directly exposed to UVB radiation, we investigated the preventive effect of FA on UVB-radiation induced cytotoxicity, DNA damage and repair signaling, mutagenesis, lipid peroxidation and antioxidants status in cultured skin fibroblast cells.


   Materials and methods Top


Chemicals

Human dermal fibroblast adult (HDFa)-500K cells/vials were purchased from Invitrogen Bioservices, India (Catalogue No: C0135C). Medium 106 (Catalog No: M-106-500), low serum growth supplement (LSGS; Catalog No: S-003-10), fetal bovine serum, hydrocortisone, human epidermal growth factor, basic fibroblast growth factor, heparin, trypsin/ethylenediaminetetraacetic acid (EDTA) solution (Catalog No: R-001-100) and trypsin neutralizer solution (Catalogue No: R-002-100) were purchased from Cascade Biologics, Invitrogen cell culture, India. Ferulic acid, 3-(4, 5-dimethyl-2-thiaozolyl)-2, 5-diphenyl-2H tetrazolium bromide (MTT), 2,7-diacetyl dichlorofluorescein (DCFH-DA) and rhodamine 123 were purchased from Sigma Co., St. Louis, USA. Low melting agarose (LMPA), normal melting agarose (NMPA), phosfate-buffered saline (PBS) and all other chemicals, solvents of analytical grades were obtained from S.D Fine Chemical, Mumbai and Fisher Inorganic and Aromatic Limited, Chennai. Medox-Bio TM Ames test kit was purchased from Medox Biotech India Pvt. Ltd. The RNeasy mini kit was purchased from Qiagen, USA. Quantitative real-time polymerase chain reaction (qRT-PCR) teaching kit was purchased from Merk Specialty Pvt. Ltd, Mumbai.

Human skin dermal fibroblasts adult cell culture

Human dermal fibroblast adult cells (HDFa) obtained from Invitrogen Bioservices were cultured at 37°C in 5% CO 2 in medium 106 supplemented with LSSG kit (fetal bovine serum 2% v/v, hydrocortisone 1 μg/ml, human epidermal growth factor 10 ng/ml, basic fibroblast growth factor 3 ng/ml, heparin 10 ng/ml and antibiotics). The cells were allowed to grow for 7 days to reach the maximum confluence. After reaching 80-90% confluence the cells were sub-cultured and used for further experiments. Cultured human dermal fibroblasts were divided into six groups as follows:

  • Group 1-control (sham UVB-irradiated fibroblasts)
  • Group 2-FA treated HDFa (40 μg/ml)
  • Group 3-UVB irradiated HDFa (19.8 mJ/cm 2 )
  • Group 4-UVB irradiated + 10 μg/ml of FA pretreated HDFa
  • Group 5-UVB irradiated + 20 μg/ml of FA pretreated HDFa
  • Group 6-UVB irradiated + 40 μg/ml of FA pretreated HDFa.


Treatment of the HDFa cells

Thirty minutes prior to irradiation, four test doses (10, 20 and 40 μg/ml) of FA were added to the grouped HDFa cells. Preliminary studies were carried out to ensure that whether these concentrations had any toxic effect by trypan blue dye exclusion test. Before exposure to UV light, the cells were washed twice with PBS solution. Non-irradiated and FA-treated HDFa cells showed no decrease in viability during the period of incubation.

Irradiation procedure

Culture of HDFa cells were washed once with PBS and exposed to UVB radiation in a thin layer of culture medium. The culture medium was later removed and covered with a UV permeable membrane to prevent contamination. A battery of TL 20 W/20 fluorescent tubes (Heber Scientific) served as UVB source, which had a wavelength range set 290-320 nm peaked at 312 nm and an intensity of 2.2 m W/cm 2 for 9 min. The total UVB-irradiation was 19.8 mJ/cm 2 , with an average value of 1.52 × 10 -3 mJ / cell. After irradiation the HDFa cells were kept at room temperature for 30 min. Cells were then washed twice with PBS, scraped gently, and transferred to sterile tubes for further analysis.

MTT based cytotoxicity assay

The MTT assay is a colorimetric non-radioactive assay for measuring cell viability through increased metabolism of tetrazolium salt. [15] Cultured fibroblasts seeded at a density of 1 × 10 6 cells/ml was taken into 96 well plates. Then the cells were treated with different concentration of FA (10, 20 and 40 μg/ml). After 30 min incubation with FA treatment, the cells were exposed to UVB-irradiation. Then the cells were incubated in the presence of 5% CO 2 at 37°C for 24 h. The MTT (0.5 mg/ml) was added to the cells and then further incubated for another 4 h. The cells were centrifuged for 10 min and the supernatant was removed, 200 μl of dimethyl sulfoxide (DMSO) were added into each tubes. Absorbance was measured in a microplate reader at 560 nm.

Quantification of intracellular ROS

The intracellular ROS levels were measured by DCFH-DA method. [16] The diacetate group of DCFH-DA allows it to diffuse into the cells where the esterase react with oxidants, and upon oxidation, the probes become fluorescent and are thus amenable to quantify spectrofluoremetically. FA-pretreated and/or UVB-treated fibroblasts in six well plates were incubated for 15 min with 10 μM DCFH-DA in PBS, washed three times with PBS. Fluorescence was determined at 488/525 nm by spectrofluorometer.

Estimation of membrane lipid peroxidation and cellular antioxidants

Fibroblasts were suspended in 130 mM KCl plus 50 mM PBS containing 0.1 mL of 0.1 M dithiothreitol and centrifuged at 2,000 rpm for 15 min (4°C). The supernatant was taken for biochemical estimation. The level of lipid peroxidation was determined by analyzing TBA-reactive substance according to the protocol of Niehaus and Samuelsson. [17] The pink colored chromogen formed by the reaction of 2-TBA with breakdown products of lipid peroxidation was measured. Superoxide dismutase (SOD) activity was assayed by the method of Kakkar et al., [18] based on the inhibition of the formation of NADH-PMS-NBT complex. Catalase (CAT) activity was assayed by the procedure of Sinha, [19] quantifying the hydrogen peroxide after reacting with dichromate in acetic acid. The activity of glutathione peroxidase (GPX) was assayed by the method of Rotruck et al., [20] a known amount of enzyme preparation was allowed to react with hydroperoxides (H 2 O 2 ) and glutathione (GSH) for a specified time period. Then, the GSH content remaining after the reaction was measured. The total GSH content was measured by the method of Ellman. [21] This method was based on the development of a yellow color when 5, 5-dithiobis 2-nitrobenzoic acid was added to compound containing sulfhydryl groups.

Evaluation of antimutagenic effect of FA against UVB-induced mutagenesis

The mutagenesis test was originally developed by Maron and Ames in the early 1983. [22] This assay measures genetic damage at the single base level in DNA by using an Escherichia coli AB1157 test strain. The E. coli strain AB1157 used in the assay has unique mutation (His - ) that has turned off histidine biosynthesis. Because of this mutation, the bacteria requires exogenous histidine to survive and will starve to death if grown without this essential nutrient (auxotrophy). During a mutagenic event, E. coli AB1157 undergoes reverse mutation and turning the essential gene back grown in the absence of histidine (His - to His + ). The E. coli strains (His - ) were incubated for 24 h at 37°C in Luria-Bertani (LB) broth with 0.5% NaCl. After UVB-irradiation and/or FA treatment cell suspensions were serially diluted using PBS and the dilutions were spread plated on minimal soft agar plates and incubated at 37°C for 48-72 h in an incubator. Number of reverted colonies present in the plates during different treatment condition were enumerated and recorded. A sample was considered to be mutagenic when the numbers of revertant colonies were more than the non-irradiated control yield.

Alkaline single-cell gel electrophoresis (comet assay)

DNA damage was estimated by alkaline single-cell gel electrophoresis (comet assay) according to the method of Singh et al.[23] A layer of 1% NMPA was prepared on microscope slides. After UVB-irradiation, HDFa cells (50 μl) were mixed with 200 μl of 0.5% LMPA. The suspension was pipette onto the precoated slides. Slides were immersed in cold lysis solution at pH 10 (2.5 M NaCl, 100 mM Na 2 EDTA, 10 mM Tris pH 10, 1% Triton X-100, 10% DMSO) and kept at 4°C for 60 min. To allow DNA unwinding, the slides were placed in alkaline electrophoresis buffer at pH 13 and left for 25 min. Subsequently, the slides were transferred to an electrophoresis tank with fresh alkaline electrophoresis buffer and the electrophoresis was performed at field strength of 1.33 V/cm for 25 min at 4°C. Slides were neutralized in 0.4 M Tris (pH 7.5) for 5 min and stained with 20 μg/ml ethidium bromide. For visualization of DNA damage, observations were made using a 40 × objective in an epifluorescent microscope equipped with an excitation filter of 510-560 nm and a barrier filter of 590 nm. One to two hundred comets on duplicated slides were analyzed. Images were captured with a digital camera with networking capability and analyzed by image analysis software, Comet Assay Software Project (CASP). DNA damage was quantified by tail moment, tail length, and olive tail moment (OTM).

Changes in mitochondrial transmembrane potential (ΔΨm)

The changes in ΔΨm in different treatment groups were observed microscopically and determined spectrofluorometrically using fluorescent dye Rh-123. To the treated and control HDFa, 1μl of rhodamine-123 (5 mmol) was added and kept in the incubator for 30 min. [24] The cells were then washed with PBS and observed with a fluorescence microscope using blue filter (450-490 nm). Polarized mitochondria emit orange-red fluorescence and depolarized mitochondria emit green fluorescence.

Detection of apoptotic nuclei by EB/AO staining

Ethidium bromide/acridine orange (EB/AO) staining was carried out to detect morphological evidence of apoptosis on the FA and UVB-irradiated cells. [25] The cells were fixed in 3:1 ratio of methanol and glacial acetic acid for 1 h at room temperature. The cells were labeled with 1:1 ratio of AO (100 μg/ml) and EB (100 μg/ml) in PBS and incubated for 5 min then the excess unbinding dye was removed by washing with PBS. Stained cells were visualized under UV illumination using the 40 × objective (Nikon fluorescence microscope) and the digitized images were captured. The apoptotic cells, with the shrunken, nuclear fragmentation, brightly fluorescent, apoptotic nuclei, were easily detected through their high fluorescence and the percentage apoptotic cells were calculated.

qRT-PCR for analysis of DNA repair gene expression

Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) for the mRNA expression of XRCC1, GADD 45α0 and HOGG1 in HDFa were performed using real-time PCR. [26] RNA purification and quantity were analyzed spectrophotometrically at OD260/OD280 nm. Samples were run in triplicate to ensure amplification integrity. Manufacturer-supplied (Sigma Aldrich, Bangalore, India) primer pairs were used to measure the mRNA expression. For cDNA synthesis, PCR cyclic condition used were 25°C for 10 min; 42°C for 50 min; 75°C for 15 min. The cyclic condition used for cDNA amplification was 95°C for 5 minutes; 94°C for 15 sec; 62°C for 20 sec: 72°C for 20 sec and final extension at 72°C for 5 minutes as recommended by the primer's manufacturer. The expression levels of genes were normalized to the expression level of the 18S mRNA in each sample. 18S rRNA housekeeping gene expression was used for normalization. The specific primer sequences for PCR were as follows: For human XRCC1 FP: 5′CTGGGGAGTAGGACGTCAGTGCTG3′RP: 5′GGCTTGCGGCACCACCCCATAGAGC3′ for human GADD45α FP: 5′CTAGCCGTGGCAGGAGCAGC3′ RP: 5′- TGAGCAGCTTGGCCGCTTCG -3′ for human HOGG1 FP: 5′CCTCCTCCCCTTCCCTTCAACCAAG3′ RP: 5′- TTGGCCCACACGAGGTCCAGA -3′ and for 18s RNA FP: 5′- AGGAATTCC CAGTAAGTGCG -3′ RP: 5′ GCCTCACTAAACCATCCAA 3′.

Statistical analysis

All the values were expressed as means of six (n = 6) determinations. The data were statistically analyzed using one-way analysis of variance (ANOVA) on statistical package for social sciences (SPSS) and the group means were compared by Duncan's multiple range test (DMRT). The results were considered statistically significant if the P value is the 0.5 levels. Values are given as means ± SD of six experiments in each group. Values not sharing a common marking (a, b, c.) differ significantly at P < 0.05 (DMRT).


   Results Top


Protective effect of FA against UVB-induced cytotoxicity in HDFa cells

In this study, one time UVB exposure significantly decreased HDFa viability. It has been found that only 28.57% of cell viability after 30 min UVB-exposure [Figure 1]. Conversely, FA pre-treatment significantly prevented UVB-induced cell death and restored cell viability in a concentration-dependent manner. Among all the test doses tested, 40 μg/ml of FA restored about 98% cell viability in HDFa cells.
Figure 1: Effect of FA on UVB-induced cytotoxicity in HDFa by MTT assay. Data were given as means ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT)

Click here to view


FA inhibits the ROS levels in UVB treated HDFa cells

The intracellular ROS production was significantly higher in UVB irradiated HDFa cells (FI 644.66) compared to the control (FI 259.83) and FA alone treated cells (FI 254.78). FA pretreatment significantly decreased the intracellular ROS production in UVB irradiated HDFa cells in a dose-dependent manner. Among all the concentrations studied, 40 μg/ml of FA treatment almost restored ROS accumulation to the basal level [Figure 2]a and 2b].
Figure 2:

Click here to view


Effect of FA on lipid peroxidation and antioxidant status in HDFa cells

Levels of TBARS were increased significantly in UVB-irradiated HDFa cells [Figure 3]. FA pretreatment shows progressively decreased levels of TBARS when compared with UVB- irradiated HDFa cells. Our study shows that UVB-irradiation caused significant decrease in the activities of enzymatic antioxidants such as SOD, CAT and GPX in HDFa cells [Figure 4]. Significantly increased activities of SOD, CAT, GPX and GSH were observed in FA pretreated HDFa cells.
Figure 3: Effect of FA on UVB-induced lipid peroxidation in HDFa. Values are given as means ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT)

Click here to view
Figure 4: Effect of FA on the levels of enzymatic antioxidants *SOD, **CAT, *** GPX and GSH in normal, UVB-irradiated and FA pretreated HDFa cells. Values are given as mean ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT). *Enzyme concentration required for 50% inhibition of nitroblue tetrazolium reduction in 1 min. **Micromoles of hydrogen peroxide consumed per minute. ***Micrograms of glutathione consumed per minute

Click here to view


Antimutagenic effect of FA on UVB-induced mutagenesis

The plate incorporation procedure developed by Ames was used for antimutagenic effect of FA. Marked increase in the number of revertant colonies was observed in the UVB-exposed cells compared with control group. No mutagenicity was observed in FA alone treated group. Whereas, FA pre-treated plus UVB-irradiated showed significantly decreased number of revertant colonies. This indicates the antimutagenic activity of FA against UVB-induced mutagenesis [Figure 5].
Figure 5: Effect of FA on UVB-radiation induced mutagenesis in E. coli AB1157. Results are shown as means ± SD of six independent determinations. Values not sharing a common marking (a, b, c...) differ significantly at P < 0.05 (DMRT)

Click here to view


Inhibitory effect of FA on UVB caused DNA damage (Comet assay)

UVB-irradiation significantly increased % head DNA, tail length, tail moment and OTM in HDFa cells [Figure 6]. FA (10, 20, 40 μg/ml) pretreatment significantly decreased the levels of DNA damage in a concentration-dependent manner.
Figure 6: Effect of FA on DNA damage (% tail DNA, tail length, tail moment and Olive tail moment) in normal, UVB-irradiated and FA pretreated HDFa cells. Values are given as means ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT)

Click here to view


Inhibitory effect of FA on UVB-induced mitochondrial membrane potential

[Figure 7]a and 7b show the changes in the levels of mitochondrial membrane potential in the normal, UVB plus FA pretreated HDFa cells. UVB treatment significantly decreased the mitochondrial membrane potential levels (FI 259.5). In HDFa pre-treatment with FA (10, 20 and 40 μg/ml) significantly prevented loss of mitochondrial membrane potential in a dose-dependent manner.
Figure 7:

Click here to view


Effect of FA on UVB-induced apoptotic morphological changes

[Figure 8] shows the apoptotic morphological changes in normal, UVB plus FA pretreated HDFa cells. The amount of nuclear fragmentation and apoptotic incidence were dramatically reduced when the cells were pretreated with FA.
Figure 8: Effect of FA on UVB-induced apoptotic morphological changes in HDFa cells assessed using EB/AO staining. UVB exposure increased apoptotic cell death and DNA fragmentation in HDFa. FA treatment (10, 20 and 40 μg/ml) before UVB exposure reduced percentage of apoptotic cells. Values are given as mean ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT)

Click here to view


Effect of FA on mRNA expressions in UVB irradiated HDFa

Reverse transcriptase PCR analysis was adopted to analyze the effect of FA on UVB-induced mRNA expression levels in the HDFa. The mRNA levels of XRCC1, GADD45α and HOGG1 were overexpressed in UVB-exposed HDFa than non-UVB-exposed control HDFa. FA pretreatment (40 μg/ml) down-regulated this expression pattern of these gene expressions in HDFa [Figure 9].
Figure 9: Inhibitory effect of FA on UVB-radiation induced XRCC1, GADD45 and hogg1 mRNA expressions. Values are given as mean ± SD of six experiments in each group. Values not sharing a common superscript differ significantly at P < 0.05 (DMRT)

Click here to view



   Discussion Top


UVB radiation emitted from sun permeates the atmosphere and penetrates dermis layer of skin which then lead to number pathological consequences. UVB-induced ROS contributes to photoaging and skin cancer formation. [27] Hence, development of "photoprotectors" especially from natural origin is a highly desirable goal. UVB radiation is known to interact with cellular porphyrins, flavones and cytochromes resulting in the generation of ROS. [28] According to previous report, FA seems to be an ideal antioxidant and scavenges ROS in free radical scavenging systems. [13] In this study, FA pretreatment significantly prevented UVB-induced cytotoxicity in HDFa [Figure 1]. Pervious study showed that UVB-exposure caused cytotoxicity in HDFa; however, cells treated with phytochemicals before UVB-exposure showed significantly decreased cell viability. [29] UVB-exposure disrupts membrane integrity and inhibits mitochondrial dehydrogenase activity. [30] This might be one of the reasons for UVB-induced cytotoxicity. It has been established that sesamol, a dietary phenol, reversed UVB-induced cell death in lymphocytes. [31] Caffeic acid (CA), a similar phytochemical, treatment significantly decreased UV induced cell death [32] and CA significantly increases human skin cell proliferation activity after UVC-irradiation in vitro and the cytoprotective effect of CA against UVC was more efficient than α-tocopherol in human skin cells. [33]

Many findings provide evidence that the primary mechanism by which UV irradiation initiates molecular responses in human skin by generation of ROS. [34],[35] Therefore, the antioxidants from natural origin appear to be highly promise and their use may be an effective strategy for reduction of incidence of skin cancer and UV-oxidative damage. [36] In this study, FA treatment significantly prevented UVB-induced ROS generation and this might be the antioxidant potential of this compound [Figure 2]a and 2b]. If the ROS remain, without being scavenged in the biological system, they can induce biochemical alterations, including inflammation, oxidation of lipids, proteins, DNA damage and activation or inactivation of certain enzymes. [37] Lipid components in the membranes are highly susceptible to radiation damage. [38] We observed increased TBARS production in UVB-irradiated cells. Previous studies demonstrated that the TBARS formation in irradiated lymphocytes can be inhibited by FA pretreatment. [15] FA also prevents lipid peroxidation in rat liver microsomes [39] and diabetic rats. [40] Similarly, FA pretreatment shows progressively decreased levels of TBARS in UVB irradiated HDFa cells [Figure 3]. The impairment of antioxidants function results in the accumulation of ROS. [41] Antioxidant enzymes including SOD, CAT, and GPX act in concert to protect cellular components from damage by ROS, which represents the primary line of defense. [42] Previous study has demonstrated that a polypeptide isolated from Chlamys farreri increases the activities of antioxidative enzymes in UVB irradiated HaCaT cells. [43] In this study, FA pretreatment significantly increased activities of SOD, CAT, GPX and GSH in UVB irradiated HDFa cells [Figure 4] and thus, FA could exert a beneficial action against pathologic alterations caused by the UVB radiation. Phenolics are powerful hydrogen-donating antioxidants and free-radical scavengers in several in vitro systems [44] and in vivo models. [45]

GSH is a versatile protector and executes radioprotective function through free-radical scavenging, restoration of the damaged molecule by hydrogen donation, reduction of peroxides and maintenance of protein thiols in the reduced state. [46] UVB- irradiation of HDFa causes a significant decrease in the levels of GSH. FA pretreatment significantly increased GSH levels in UVB irradiated HDFa cells [Figure 4]. Decreased levels of GSH during UVB exposure may be due to the leakage and oxidation of GSH. [47] GSH depletion of cultured human skin cells make them sensitive to UVB-induced mutations and cell death. [48] FA possesses three distinctive structural motifs that can possibly contribute to the free-radical scavenging capability of this compound. The presence of electron donating group on the benzene ring (3-methoxy, and more importantly 4-hydroxyl) of FA gives additional resonance structures of the resulted phenoxyl radical, contributing to the stability of this intermediate or even terminating free-radical chain reaction. The C-O group with the adjacent unsaturated C-C double bond can contribute to the stability of the radical via resonance or by providing additional attack sites for free radicals. [49] This might be the reason for the protective effect of FA against UVB radiation-induced cytotoxicity, lipid peroxidation and antioxidant depletion, as well as scavenging of ROS in HDFa cells.

Some evidence suggests that UVB generates ROS and it has been associated with oxidative DNA damage. [50] We observed increased frequency of DNA damage i.e. tail DNA, tail length, tail moment and OTM in UVB-irradiated HDFa cells [Figure 5]. Increased comet attributes observed in this study might be due to the DNA strand breaks induced during UVB-exposure. UVB-radiation has been known to induce pyrimidine dimer and (6-4) photoproducts. [51] FA pretreatment decreased percentage of tail DNA, tail length, tail moment and OTM in HDFa cells. This clearly indicates DNA damage repairing capacity of FA in UVB-irradiated HDFa cells. It has been previously proved that CA pretreatment significantly reduced ultraviolet radiation-B induced DNA damage in cultured human lymphocytes. [32] Protective effect of CA phenyl ester on tert-butyl hydroperoxides-induced oxidative hepatotoxicity and DNA damage has been recently demonstrated. [52] In the present study, results of Ames test showed a positive mutagenic response by the formation of revertant colonies during UVB-exposure. FA pretreatment strongly inhibited the bacterial mutagenesis induced by UVB-radiation [Figure 6]. This clearly indicates antimutagenic effect of FA against UVB-irradiation.

Mitochondrial changes are critical for the inductive effect phase of apoptosis. The loss of ΔΨm signifies metabolic cell death. [30] We used rhodamine 123 to assess the effect of FA treatments on ΔΨm in UVB-irradiated HDFa cells. The reduction of ΔΨm has been shown to be associated with UVB-induced apoptosis. [30],[53] In agreement with these findings, we observed the accumulation of rhodamine-123 dye in control group; the dye accumulations were decreased in UVB-treated cells. FA treatment before UVB-exposure significantly prevented UVB-induced loss of ΔΨm in a dose-dependent manner [Figure 7]a and 7b]. These results suggest that protection of mitochondria by FA could be implicated in its antiapoptotic function. Previous studies suggest that the 30 mJ/cm 2 UVB led to significant apoptosis of HaCa T cells, accompanied by a marked reduction of ΔΨm. Interestingly, polypeptide from Chlamys farreri (PCF) added before UVB-irradiation counteracted the reduction of ΔΨm while PCF added after the irradiation had no such effect any more. These results suggest that protection of mitochondria by FA could be implicated in its antiapoptotic function. UVB radiation is the primary environmental agent that leads to apoptosis in human cells. UVB-irradiation of cells elicits a complex cellular response via cell surface receptor aggregation [54],[55] and upon prolonged exposure; it induces apoptosis in mammalian cells including keratinocytes and lymphocytes. [56] In agreement with this, we observed the protective effect of FA on UVB radiation-induced apoptotic morphological changes. The amount of fragmentation and destruction of irradiated cells were dramatically reduced when the cells were treated with FA [Figure 8].

The main damages resulting from UV light are pyrimidine dimers, which can be divided into the major induced photoproducts: cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone dimers ((6-4) photoproducts; (6-4) PPs). [57] The effects of UVB radiation on DNA are mostly caused by the formation of dimeric photoproducts between adjacent pyrimidine bases on the same strand. [27] Important mechanisms in human cells to avoid the potential mutation in UV-induced damaged sites are to completely repair the damage by nucleotide excision repair (NER) and base excision repair (BER) before replication or synthesize DNA using post-replication repair specific DNA polymerase, which is free from error. The DNA repair protein XRCC1 (X-ray repair cross complementing protein1) appears to act as an early responder of DNA breaks at stalled replication forks and as a part of the BER pathway, which is involved in repair of DNA single-strand breaks. [58] The enhanced XRCC1 expression observed in this study may be due to increased DNA damage occurred during UVB-exposure. The GADD45 (growth arrest and DNA damage inducible protein 45) family is comprised of small (18 kDa) stress-inducible acidic nuclear proteins. The three family members - GADD45a, GADD45b and GADD45 g - are implicated in diverse processes including cell cycle control, apoptosis and DNA repair. The role of GADD45 proteins upon UV response is well characterized in cultured cells and adult mice. [59] Mice with a GADD45 gene deletion show genomic instability and increased sensitivity to carcinogenesis. [60] The enhanced gadd45 expression observed in this study may be due to increased DNA damage occurred during UVB-exposure. FA pretreatment attenuated the GADD45α gene expressions in the UVB-irradiated HDFa. Human 8-oxoguanine-DNA glycosylase 1 (HOGG1) is the main enzyme that excises 8-oxo-dG from damaged DNA via the base-excision repair pathway. [61] Furthermore, basal cells in human epidermis are particularly sensitive to UVA-mediated DNA damage probably due to low expression of HOGG1. [62] In this study, we observed increased HOGG1 (human ogg1) in acute UVB-exposed HDFa. This might be explained considering the dynamic steady state of oxidative DNA damage during UVB-exposure. On the other hand, FA pretreatment decreased the expression of hogg1 in HDFa. As FA prevents UVB-induced DNA damage there might be a subsequent loss of overexpression of DNA repair signaling in UVB plus FA treated HDFa. This indicates FA is not acted at the molecular level instead it may act as a potent sunscreen in HDFa.

Thus, in the present study, we observed oxidative stress mediated damage in UVB-irradiated cells. FA was effective in protection against UVB radiation-induced cytotoxicity, lipid peroxidation, DNA damage and antioxidant depletion, by preventing UVB-induced ROS generation. Therefore, interventions with FA could be a promising mode in the design and development of new sunscreen and photoprotective agents. However, the bioavailability of FA might be a major concern due to its rapid conjugation process in the liver. [63] The bioavailability of FA for better photoprotection may be achieved by preparing novel FA nanoformulations or by transdermal delivery.

 
   References Top

1.Atlanta GA. Cancer facts and figures. Am Cancer Soc 2001;8:105-108.  Back to cited text no. 1
    
2.O'Shaughnessy JA, Kelloff GJ, Gordon GB, Dannenberg AJ, Hong WK, Fabian CJ, et al. Treatment and prevention of intraepithelial neoplasia: An important target for accelerated new agent development. Clin Cancer Res 2002;8:314-46.  Back to cited text no. 2
    
3.Ikehata H, Ono T. The Mechanisms of UV mutagenesis. J Radiat Res 2011;52:115-25.  Back to cited text no. 3
    
4.Kulms D, Schwarz T. Molecular mechanisms of UV-induced apoptosis. Photodermatol Photoimmunol Photomed 2000;16:195-201.  Back to cited text no. 4
    
5.Afaq F. Natural Agents: Cellular and molecular mechanisms of photoprotection. Arch Biochem Biophys 2011;508:144-51.  Back to cited text no. 5
[PUBMED]    
6.Strozyk E, Kulms D. The role of AKT/mTOR pathway in stress response to UV-irradiation: Implication in skin carcinogenesis by regulation of apoptosis, autophagy and senescence. Int J Mol Sci 2013;14:15260-85.  Back to cited text no. 6
    
7.Katiyar SK, Afaq F, Azizuddin K, Mukhtar H. Inhibition of UVB-induced oxidative stress-mediated phosphorylation of mitogen-activated protein kinase signaling pathways in cultured human epidermal keratinocytes by green tea polyphenol (-)-epigallocatechin-3-gallate. Toxicol Appl Pharmacol 2001;176:110-7.  Back to cited text no. 7
    
8.Vicentini FT, He T, Shao Y, Fonseca MJ, Verri WA Jr, Fisher GJ, et al. Quercetin inhibits UV irradiation-induced inflammatory cytokine production in primary human keratinocytes by suppressing NF-kB pathway. J Dermatol Sci 2011;61:162-8.  Back to cited text no. 8
    
9.Vaid M, Katiyar SK. Molecular mechanisms of inhibition of photocarcinogenesis by silymarin, a phytochemical from milk thistle (Silybum marianum L. Gaertn) (Review). Int J Oncol 2010;36:1053-60.  Back to cited text no. 9
    
10.Adhami VM, Syed DN, Khan N, Afaq F. Phytochemicals for prevention of solar ultraviolet radiation-induced damages. Photochem Photobiol 2008;84:489-500.  Back to cited text no. 10
    
11.Khambete N, Kumar R. Carcinogens and cancer preventors in diet. Int J Nutr Pharmacol Neurol Dis 2014;4.  Back to cited text no. 11
    
12.Sudheer AR, Muthukumaran S, Kalpana C, Srinivasan M, Menon VP. Protective effect of ferulic acid on nicotine-induced DNA damage and cellular changes in cultured rat peripheral blood lymphocytes: A comparison with N-acetylcysteine. Toxicol In Vitro 2007;21:576-85.  Back to cited text no. 12
    
13.Kanski J, Aksenova M, Stoyanova A, Butterfield DA. Ferulic acid antioxidant protection against hydroxyl and peroxyl radical oxidation in synaptosomal and neuronal cell culture systems in vitro: Structure activity studies. J Nutr Biochem 2002;13:273-81.  Back to cited text no. 13
    
14.Prasad NR, Srinivasan M, Pugalendi KV, Menon VP. Protective effect of ferulic acid on gamma radiation-induced micronuclei, dicentric aberration and lipid peroxidation in human lymphocytes. Mutat Res 2006;603:129-34.  Back to cited text no. 14
    
15.Moshmann T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assay. J Immunol Method 1983;65:55-63.  Back to cited text no. 15
    
16.Hafer K, Iwamoto KS, Schiestl RH. Refinement of the dichlorofluorescein assay for flow cytometric measurement of reactive oxygen species in irradiated and bystander cell populations. Radiat Res 2008;169:460-8.  Back to cited text no. 16
    
17.Niehaus WG Jr, Samuelsson B. Formation of malondialdehyde from phospholipid arachidonate during microsomal lipid peroxidation. Eur J Biochem 1968;6:126-30.  Back to cited text no. 17
[PUBMED]    
18.Kakkar P, Das B, Viswanathan PN. A modified spectrophotometric assay of superoxide dismutase. Indian J Biochem Biophys 1984;21:130-2.  Back to cited text no. 18
[PUBMED]    
19.Sinha KA. Colorimetric assay of catalase. Anal Biochem 1972;47:389-94.  Back to cited text no. 19
    
20.Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hafeman DG, Hoekstra WG. Selenium: Biochemical roles as components of glutathione peroxidise. Science 1973;179:588-90.  Back to cited text no. 20
[PUBMED]    
21.Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biopsy 1959;82:70-7.  Back to cited text no. 21
    
22.Maron DM, Ames BN. Revised methods for Salmonella mutagenicity test. Mutat Res 1983;113:173-215.  Back to cited text no. 22
[PUBMED]    
23.Singh NP, McCoy MT, Tice RR, Schneider EL. A simple technique for quantification of low levels of DNA damage in individual cells. Exp Cell Res 1988;175:184-91.  Back to cited text no. 23
    
24.Bhosle SM, Huilgol NG Mishra KP. Enhancement of radiation-induced oxidative stress and cytotoxicity in tumor cells by ellagic acid. Clin Chim Acta 2005;359:89-100.  Back to cited text no. 24
    
25.Darzynkiewiez Z, Li X, Gong J. Assay for cell viability: Discrimination of cells dying by apoptosis. Methods Cell Biol 1994;4:15-38.  Back to cited text no. 25
    
26.Sharma SD, Katiyar SK. Dietary grape seed proanthocyanidins inhibit UVB-induced cyclooxygenase-2 expression and other inflammatory mediators in UVB-exposed skin and skin tumors of SKH-1 hairless mice. Pharm Res 2010;27:1092-102.  Back to cited text no. 26
    
27.Ichihashi M, Ueda M, Budiyanto A, Bito T, Oka M, Fukunaga M, et al. UV-induced skin damage. Toxicology 2003;189:21-39.  Back to cited text no. 27
    
28.Svobodová A, Psotová J, Walterová D. Natural phenolics in the prevention of UV-induced skin damage. A review. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 2003;147:137-45.  Back to cited text no. 28
    
29.Ramachandran S, Prasad NR. Sesamol modulates ultraviolet-B-induced apoptotic and inflammatory signaling in human skin dermal fibroblasts. Int J Nutr Pharmacol Neurol Dis 2012;2:31-9.  Back to cited text no. 29
  Medknow Journal  
30.Denning MF, Wang Y, Tibudan S, Alkan S, Nickoloff BJ. Caspase activation and disruption of mitochondrial membrane potential during UV radiation induced apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ 2002;9:40-52.  Back to cited text no. 30
    
31.Prasad NR, Mahesh T, Menon VP, Jeevanram RK, Pugalendi KV. Photoprotective effect of sesamol on UVB-radiation induced oxidative stress in human blood lymphocytes in vitro. Environ Toxicol Pharmacol 2005;20:1-5.  Back to cited text no. 31
    
32.Prasad NR, Jeyanthimala K, Ramachandran S. Caffeic acid modulates ultraviolet radiation-B induced oxidative damage in human blood lymphocytes. J Photochem Photobiol B 2009;95:196-203.  Back to cited text no. 32
    
33.Nardini M, D'Aquino M, Tomassi G, Gentili V, Di Felice M, Scaccini C. Inhibition of human low-density lipoprotein oxidation by caffeic acid and other hydroxycinnamic acid derivatives. Free Radic Biol Med 1995;19:541-52.  Back to cited text no. 33
    
34.Naziya Begum, Rajendra Prasad N, Thayalan K. Apigenin protects gamma-radiation induced oxidative stress, hematological changes and animal survival in whole body irradiated Swiss albino mice. Int J Nutr Pharmacol Neurol Dis 2012;2:45-52.  Back to cited text no. 34
    
35.Heck DE, Vetrano AM, Mariano TM, Laskin JD. UVB light stimulates production of reactive oxygen species: Unexpected role for catalase. J Biol Chem 2003;278:22432-6.  Back to cited text no. 35
    
36.Tomaino A, Cristani M, Cimino F, Speciale A, Trombetta D, Bonina F, et al. In vitro protective effect of a Jacquez grapes wine extract on UVB-induced skin damage. Toxicol In Vitro 2006;20:1395-402.  Back to cited text no. 36
    
37.Widel M, Krzywon A, Gajda K, Skonieczna M, Rzeszowska-Wolny J. Induction of bystander effects by UVA, UVB and UVC radiation in human fibroblasts and the implication of reactive oxygen species. Free Radic Biol Med 2014;68:278-87.  Back to cited text no. 37
    
38.Bhattacharya S, Kamat JP, Bandyopadhyay SK, Chattopadhyay S. Comparative inhibitory properties of some Indian medicinal plant extracts against photosensitization-induced lipid damage. Food Chem 2009;113:975-9.  Back to cited text no. 38
    
39.Anselmi C, Centini M, Adreassi M, Buonocore A, La Rosa C, Facino RM, et al. Conformational analysis: A tool for the elucidation of the antioxidant properties of ferulic acid derivatives in membrane models. J Pharm Biomed Anal 2004;35:1241-9.  Back to cited text no. 39
    
40.Balasubashini MS, Rukkumani R, Viswanathan P, Menon VP. Ferulic acid alleviates lipid peroxidation in diabetic rats. Phytother Res 2004;18:310-4.  Back to cited text no. 40
    
41.Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, and aging. Cell 2005;120:483-95.  Back to cited text no. 41
    
42.Ng TB, Gao W, Li L, Niu SM, Zhao L, Liu J, et al. Rose (Rosa rugosa)-flower extract increases the activities of antioxidant enzymes and their gene expression and reduces lipid peroxidation. Biochem Cell Biol 2005;83:78-85.  Back to cited text no. 42
    
43.Liu X, Shi S, Ye J, Liu L, Sun M, Wang C. Effect of polypeptide from Chlamys farreri on UVB-induced ROS/NF-kappa B/COX-2 activation and apoptosis in HaCaT cells. J Photochem Photobiol B 2009;96:109-16.  Back to cited text no. 43
    
44.Seeram NP, Adams LS, Zhang Y, Lee R, Sand D, Scheuller HS, et al. Blackberry, black raspberry, blueberry, cranberry, red raspberry, and strawberry extracts inhibit growth and stimulate apoptosis of human cancer cells in vitro. J Agric Food Chem 2006;54:9329-39.  Back to cited text no. 44
    
45.Lala G, Malik M, Zhao C, He J, Kwon Y, Giusti MM, et al. Anthocyanin rich extracts inhibit multiple biomarkers of colon cancer in rats. Nutr Cancer 2006;54:84-93.  Back to cited text no. 45
    
46.Merwald H, Klosner G, Kokesch C, Der-Petrossian M, Honigsmann H, Trautinger F. UVA-induced oxidative damage and cytotoxicity depend on the mode of exposure. J Photochem Photobiol B 2005;79:197-207.  Back to cited text no. 46
    
47.Ali D, Verma A, Mujtaba F, Dwivedi A, Hans RK, Ray RS. UVB-induced apoptosis and DNA damaging potential of chrysene via reactive oxygen species in human keratinocytes. Toxicol Lett 2011;204:199-207.  Back to cited text no. 47
    
48.Punnonen K, Autio P, Kiistala U, Ahotupa M. In vivo effects of solar simulated ultraviolet irradiation on antioxidant enzymes and lipid peroxidation in human epidermis. Br J Dermatol 1991;125:18-20.  Back to cited text no. 48
    
49.Masuda T, Yamada K, Maekawa T, Takeda Y, Yamaguchi H. Antioxidant mechanism studies on ferulic acid: Identification of oxidative coupling products from methyl ferulate and linoleate. J Agric Food Chem 2006;54:6069-74.  Back to cited text no. 49
    
50.Saitoh Y, Miyanishi A, Mizuno H, Kato S, Aoshima H, Kokubo K, et al. Super-highly hydroxylated fullerene derivative protects human keratinocytes from UV-induced cell injuries together with the decreases in intracellular ROS generation and DNA damages. J Photochem Photobiol B 2011;102:69-76.  Back to cited text no. 50
    
51.Sugimoto M, Saitoh Y, Ichihashi M, Miwa N. Suppressive effects of phosphorylated ascorbate on ultraviolet B radiation-induced DNA damage and differential expression of the wild-type and mutated p53 tumor-suppressor gene in keratinocytes. Mol Med Rep 2009;2:917-22.  Back to cited text no. 51
    
52.Lee KJ, Choi JH, Hwang YP, Chung YC, Jeong HG. Protective effect of caffeic acid phenyl ester on tert-butyl hydroperoxide-induced oxidative hepatotoxicity and DNA damage. Food Chem Toxicol 2008;46:2445-50.  Back to cited text no. 52
    
53.Fumelli C, Marconi A, Salvioli S, Straface E, Malorni W, Offidani AM, et al. Carboxyfullerenes protect human keratinocytes from ultraviolet-B-induced apoptosis. J Invest Dermatol 2000;115:835-41.  Back to cited text no. 53
    
54.Ji C, Yang YL, Yang Z, Tu Y, Cheng L, Chen B, et al. Perifosine sensitizes UVB-induced apoptosis in skin cells: New implication of skin cancer prevention? Cell Signal 2012;24:1781-9.  Back to cited text no. 54
    
55.Brash DE, Rudolph JA, Simon JA, Lin A, Mckenna GJ, Baden HP, et al. A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci USA 1991;88:10124-8.  Back to cited text no. 55
    
56.Kanimozhi G, Prasad NR, Ramachandran S, Pugalendi KV. Umbelliferone modulates gamma-radiation induced reactive oxygen species generation and subsequent oxidative damage in human blood lymphocytes. Eur J Pharmacol 2011;672:20-9.  Back to cited text no. 56
    
57.Mannuss A, Trapp O, Puchta H. Gene regulation in response to DNA damage. Biochim Biophys Acta 2012;1819:154-65.  Back to cited text no. 57
    
58.Niu Y, Zhang X, Zheng Y, Zhang R. XRCC1 deficiency increased the DNA damage induced by ã-ray in HepG2 cell: Involvement of DSB repair and cell cycle arrest. Environ Toxicol Pharmacol 2013;36:311-9.  Back to cited text no. 58
    
59.Niehrs C, Schäfer A. Active DNA demethylation by Gadd45 and DNA repair. Trends Cell Boil 2012;22:220-7.  Back to cited text no. 59
    
60.Moskalev AA, Smit-McBride Z, Shaposhnikov MV, Plyusnina EN, Zhavoronkov A, Budovsky A, et al. Gadd45 proteins: Relevance to aging, longevity and age-related pathologies. Ageing Res Rev 2012;11:51-66.  Back to cited text no. 60
    
61.Huang XX, Scolyer RA, Abubakar A, Halliday GM. Human 8-oxoguanine-DNA glycosylase-1 is downregulated in human basal cell carcinoma. Mol Genet Metab 2012;106:127-30.  Back to cited text no. 61
    
62.Javeri A, Huang XX, Bernerd F, Mason RS, Halliday GM. Human 8-oxoguanine-DNA glycosylase 1 protein and gene are expressed more abundantly in the superficial than basal layer of human epidermis. DNA Repair (Amst) 2008;7:1542-50.  Back to cited text no. 62
    
63.Zhao Z, Egashira Y, Sanada H. Ferulic acid is quickly absorbed from rat stomach as the free form and then conjugated mainly in liver. J Nutr 2004;134:3083-8.  Back to cited text no. 63
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9]


This article has been cited by
1 Defense potential of secondary metabolites in medicinal plants under UV-B stress
Swabha Takshak,S.B. Agrawal
Journal of Photochemistry and Photobiology B: Biology. 2019; 193: 51
[Pubmed] | [DOI]
2 Marine fungal DHICA as a UVB protectant: Assessment under in vitro and in vivo conditions
S.K. Shanuja,S. Iswarya,A. Gnanamani
Journal of Photochemistry and Photobiology B: Biology. 2018; 179: 139
[Pubmed] | [DOI]
3 Pre-treatment of extracellular water soluble pigmented secondary metabolites of marine imperfect fungus protects HDF cells from UVB induced oxidative stress
S. K. Shanuja,S. Iswarya,S. Rajasekaran,M. G. Dinesh,A. Gnanamani
Photochemical & Photobiological Sciences. 2018;
[Pubmed] | [DOI]
4 Photo-protective effect of sargachromenol against UVB radiation-induced damage through modulating cellular antioxidant systems and apoptosis in human keratinocytes
Pattage Madushan Dilhara Jayatissa Fernando,Mei Jing Piao,Susara Ruwan Kumara Madduma Hewage,Hee Kyoung Kang,Eun Sook Yoo,Young Sang Koh,Mi Hee Ko,Chang Sik Ko,Sang Hee Byeon,Seung Ri Mun,Nam Ho Lee,Jin Won Hyun
Environmental Toxicology and Pharmacology. 2016;
[Pubmed] | [DOI]
5 Coffee provides a natural multitarget pharmacopeia against the hallmarks of cancer
François Gaascht,Mario Dicato,Marc Diederich
Genes & Nutrition. 2015; 10(6)
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
    Materials and me...
   Results
   Discussion
    References
    Article Figures

 Article Access Statistics
    Viewed3089    
    Printed93    
    Emailed0    
    PDF Downloaded262    
    Comments [Add]    
    Cited by others 5    

Recommend this journal